Review



shrna control  (Addgene inc)


Bioz Verified Symbol Addgene inc is a verified supplier  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 96

    Structured Review

    Addgene inc shrna control
    <t>Pathological</t> <t>TDP-43</t> elicits glycolytic impairment in cells. a , b Agilent seahorse glycolytic stress test was performed on n = 3 independent biological repeats. Glycolysis and Glycolytic Capacity were measured according to manufacturer’s protocol. ECAR values were normalized to total protein then plotted against time. Individual glycolysis and glycolytic capacity values were normalized to total protein level then to individual control from each biological repeat. a Stable HEK293 cells were overexpressed with either YFP (control), TDP-43 WT or TDP-43 ΔNLS . Data were analyzed by one-way ANOVA followed by post hoc Tukey’s test. b TDP-43 G298S patient iPSC and control iPSC were differentiated into motor neurons with our established protocol. On day 26 following differentiation, cells were treated with MG-132 (1 μM) for 24 h. Data were analyzed by Student’s t-test. c YFP (control), TDP-43 WT or TDP-43 ΔNLS stable cells were transiently transfected with various glycolysis shRNAs. Cell viability was measured via MTT assay. Decreased cell viability in all TDP-43 WT and TDP-43 ΔNLS with various glycolysis <t>shRNA</t> (n = 3). Data were analyzed by one-way ANOVA followed by post hoc Tukey’s test. All data are mean ± SE
    Shrna Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1565 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+puro+shrna/pLKO%2E1+puro+(Plasmid+%238453)/pmc12992470-33-33-35
    Average 96 stars, based on 1565 article reviews
    shrna control - by Bioz Stars, 2026-09
    96/100 stars

    Images

    1) Product Images from "TDP-43 impairs glycolysis by sequestering hexokinase 1 in amyotrophic lateral sclerosis"

    Article Title: TDP-43 impairs glycolysis by sequestering hexokinase 1 in amyotrophic lateral sclerosis

    Journal: Acta Neuropathologica

    doi: 10.1007/s00401-026-02996-6

    Pathological TDP-43 elicits glycolytic impairment in cells. a , b Agilent seahorse glycolytic stress test was performed on n = 3 independent biological repeats. Glycolysis and Glycolytic Capacity were measured according to manufacturer’s protocol. ECAR values were normalized to total protein then plotted against time. Individual glycolysis and glycolytic capacity values were normalized to total protein level then to individual control from each biological repeat. a Stable HEK293 cells were overexpressed with either YFP (control), TDP-43 WT or TDP-43 ΔNLS . Data were analyzed by one-way ANOVA followed by post hoc Tukey’s test. b TDP-43 G298S patient iPSC and control iPSC were differentiated into motor neurons with our established protocol. On day 26 following differentiation, cells were treated with MG-132 (1 μM) for 24 h. Data were analyzed by Student’s t-test. c YFP (control), TDP-43 WT or TDP-43 ΔNLS stable cells were transiently transfected with various glycolysis shRNAs. Cell viability was measured via MTT assay. Decreased cell viability in all TDP-43 WT and TDP-43 ΔNLS with various glycolysis shRNA (n = 3). Data were analyzed by one-way ANOVA followed by post hoc Tukey’s test. All data are mean ± SE
    Figure Legend Snippet: Pathological TDP-43 elicits glycolytic impairment in cells. a , b Agilent seahorse glycolytic stress test was performed on n = 3 independent biological repeats. Glycolysis and Glycolytic Capacity were measured according to manufacturer’s protocol. ECAR values were normalized to total protein then plotted against time. Individual glycolysis and glycolytic capacity values were normalized to total protein level then to individual control from each biological repeat. a Stable HEK293 cells were overexpressed with either YFP (control), TDP-43 WT or TDP-43 ΔNLS . Data were analyzed by one-way ANOVA followed by post hoc Tukey’s test. b TDP-43 G298S patient iPSC and control iPSC were differentiated into motor neurons with our established protocol. On day 26 following differentiation, cells were treated with MG-132 (1 μM) for 24 h. Data were analyzed by Student’s t-test. c YFP (control), TDP-43 WT or TDP-43 ΔNLS stable cells were transiently transfected with various glycolysis shRNAs. Cell viability was measured via MTT assay. Decreased cell viability in all TDP-43 WT and TDP-43 ΔNLS with various glycolysis shRNA (n = 3). Data were analyzed by one-way ANOVA followed by post hoc Tukey’s test. All data are mean ± SE

    Techniques Used: Control, Transfection, MTT Assay, shRNA

    Related Articles

    Produced:

    Article Title: GCN2 Has Inhibitory Effect on Human Immunodeficiency Virus-1 Protein Synthesis and Is Cleaved upon Viral Infection
    Article Snippet: The following targeted shRNAs in lentiviral construct plasmid pLKO.1-Puro were purchased from Sigma-Aldrich: GCN2 (XM_496066) Clone 1 TRCN0000078648, Clone 2 TRCN0000078649, Clone 3 TRCN0000078650, Clone 4 TRCN0000078651, Clone 5 TRCN0000078652. .. Lentiviruses were produced by co-transfection of HEK293T Phoenix cells with pLKO.1-Puro shRNA-encoding plasmids, pMD2G (Addgene) and pSPAX2 (Addgene), using jetPEI TM (PolyPlus-transfection). .. Viruses were harvested at 24 and 48 h post-transfection and infections of HeLa cells were carried out in the presence of 8 μg/ml of polybrene (Sigma-Aldrich).

    Article Title: Down-regulation of CD81 in human cells producing HCV-E1/E2 retroVLPs
    Article Snippet: Plasmids and lentivirus production : Short hairpin (sh) RNA lentiviral vectors based on pLKO.1-puro [ ] containing a puromycin resistance gene and targeting five different sequences on the human CD81 mRNA or a non-target (nt) shRNA vector were purchased from Sigma Mission® RNAi (Sigma). .. The lentiviral vector stocks were produced by transient co-transfection of 293T cells with pSPAX2, pMD2G (Addgene) and the respective pLKO.1-puro-shRNA. .. Flow cytometry for CD81 detection : The presence of CD81 on the cell membrane was detected by flow cytometry using mouse monoclonal antibody against human CD81 and an Alexa FluorR 488 dye conjugated secondary antibody (Invitrogen).

    Article Title: APOBEC2 is a Transcriptional Repressor required for proper Myoblast Differentiation
    Article Snippet: .. Virions were produced by co-transfection of pLKO.1-puro shRNA containing construct, packaging plasmid psPAX2 (Addgene, #12260) and envelope plasmid pMD2.g (Addgene, #12259) in 293T cells (CRL-3216, ATCC). .. Transfections were done using Lipofectamine 2000 Reagent (Invitrogen) as per manufacturer instructions.

    shRNA:

    Article Title: GCN2 Has Inhibitory Effect on Human Immunodeficiency Virus-1 Protein Synthesis and Is Cleaved upon Viral Infection
    Article Snippet: The following targeted shRNAs in lentiviral construct plasmid pLKO.1-Puro were purchased from Sigma-Aldrich: GCN2 (XM_496066) Clone 1 TRCN0000078648, Clone 2 TRCN0000078649, Clone 3 TRCN0000078650, Clone 4 TRCN0000078651, Clone 5 TRCN0000078652. .. Lentiviruses were produced by co-transfection of HEK293T Phoenix cells with pLKO.1-Puro shRNA-encoding plasmids, pMD2G (Addgene) and pSPAX2 (Addgene), using jetPEI TM (PolyPlus-transfection). .. Viruses were harvested at 24 and 48 h post-transfection and infections of HeLa cells were carried out in the presence of 8 μg/ml of polybrene (Sigma-Aldrich).

    Article Title: RNA degradation eliminates developmental transcripts during murine embryonic stem cell differentiation via CAPRIN1-XRN2
    Article Snippet: .. pLKO.1-puro shRNA , Addgene , Cat#8453. .. pSpCas9(BB)-2A-GFP (PX458) , Addgene , Cat#48138.

    Article Title: SGK1 suppresses ferroptosis in ovarian cancer via NRF2-dependent and -independent pathways.
    Article Snippet: High-grade serous ovarian cancer (HGSOC) is a highly aggressive disease often developing resistance to current therapies, necessitating new treatment strategies.. Our study identifies SGK1, a key effector in the PI3K pathway, as a promising therapeutic target to exploit ferroptosis, a distinct form of cell death induced by iron overload and lipid peroxidation.. Importantly, SGK1 activation, whether through high expression or the constitutively active SGK1-S422D mutation, confers resistance to ferroptosis in HGSOC.

    Article Title: APOBEC2 is a Transcriptional Repressor required for proper Myoblast Differentiation
    Article Snippet: .. Virions were produced by co-transfection of pLKO.1-puro shRNA containing construct, packaging plasmid psPAX2 (Addgene, #12260) and envelope plasmid pMD2.g (Addgene, #12259) in 293T cells (CRL-3216, ATCC). .. Transfections were done using Lipofectamine 2000 Reagent (Invitrogen) as per manufacturer instructions.

    other:

    Article Title: Down-regulation of CD81 in human cells producing HCV-E1/E2 retroVLPs
    Article Snippet: All cells were maintained in Dulbecco’s modified Eagle’s medium (DMEM) (Gibco) 10% (v/v) Foetal Bovine Serum (FBS) (Gibco).

    Construct:

    Article Title: SGK1 suppresses ferroptosis in ovarian cancer via NRF2-dependent and -independent pathways.
    Article Snippet: High-grade serous ovarian cancer (HGSOC) is a highly aggressive disease often developing resistance to current therapies, necessitating new treatment strategies.. Our study identifies SGK1, a key effector in the PI3K pathway, as a promising therapeutic target to exploit ferroptosis, a distinct form of cell death induced by iron overload and lipid peroxidation.. Importantly, SGK1 activation, whether through high expression or the constitutively active SGK1-S422D mutation, confers resistance to ferroptosis in HGSOC.

    Article Title: APOBEC2 is a Transcriptional Repressor required for proper Myoblast Differentiation
    Article Snippet: .. Virions were produced by co-transfection of pLKO.1-puro shRNA containing construct, packaging plasmid psPAX2 (Addgene, #12260) and envelope plasmid pMD2.g (Addgene, #12259) in 293T cells (CRL-3216, ATCC). .. Transfections were done using Lipofectamine 2000 Reagent (Invitrogen) as per manufacturer instructions.

    Plasmid Preparation:

    Article Title: Down-regulation of CD81 in human cells producing HCV-E1/E2 retroVLPs
    Article Snippet: Plasmids and lentivirus production : Short hairpin (sh) RNA lentiviral vectors based on pLKO.1-puro [ ] containing a puromycin resistance gene and targeting five different sequences on the human CD81 mRNA or a non-target (nt) shRNA vector were purchased from Sigma Mission® RNAi (Sigma). .. The lentiviral vector stocks were produced by transient co-transfection of 293T cells with pSPAX2, pMD2G (Addgene) and the respective pLKO.1-puro-shRNA. .. Flow cytometry for CD81 detection : The presence of CD81 on the cell membrane was detected by flow cytometry using mouse monoclonal antibody against human CD81 and an Alexa FluorR 488 dye conjugated secondary antibody (Invitrogen).

    Article Title: APOBEC2 is a Transcriptional Repressor required for proper Myoblast Differentiation
    Article Snippet: .. Virions were produced by co-transfection of pLKO.1-puro shRNA containing construct, packaging plasmid psPAX2 (Addgene, #12260) and envelope plasmid pMD2.g (Addgene, #12259) in 293T cells (CRL-3216, ATCC). .. Transfections were done using Lipofectamine 2000 Reagent (Invitrogen) as per manufacturer instructions.



    Similar Products

    96
    Addgene inc shrna control
    <t>Pathological</t> <t>TDP-43</t> elicits glycolytic impairment in cells. a , b Agilent seahorse glycolytic stress test was performed on n = 3 independent biological repeats. Glycolysis and Glycolytic Capacity were measured according to manufacturer’s protocol. ECAR values were normalized to total protein then plotted against time. Individual glycolysis and glycolytic capacity values were normalized to total protein level then to individual control from each biological repeat. a Stable HEK293 cells were overexpressed with either YFP (control), TDP-43 WT or TDP-43 ΔNLS . Data were analyzed by one-way ANOVA followed by post hoc Tukey’s test. b TDP-43 G298S patient iPSC and control iPSC were differentiated into motor neurons with our established protocol. On day 26 following differentiation, cells were treated with MG-132 (1 μM) for 24 h. Data were analyzed by Student’s t-test. c YFP (control), TDP-43 WT or TDP-43 ΔNLS stable cells were transiently transfected with various glycolysis shRNAs. Cell viability was measured via MTT assay. Decreased cell viability in all TDP-43 WT and TDP-43 ΔNLS with various glycolysis <t>shRNA</t> (n = 3). Data were analyzed by one-way ANOVA followed by post hoc Tukey’s test. All data are mean ± SE
    Shrna Control, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+puro+shrna/pLKO%2E1+puro+(Plasmid+%238453)/pmc12992470-33-33-35
    Average 96 stars, based on 1 article reviews
    shrna control - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc addgene plko 1 p53 shrna
    Reduction of nuclear size during the direct conversion of human fibroblasts to neurons (A) Schematic for the transdifferentiation of human fibroblasts to iNs by lentiviruses expressing ASCL1, miR124-9-9 ∗ -BclxL, and <t>p53</t> shRNA (AMp, uppercase for overexpression and lowercase for knockdown). –FBS, serum withdrawal to synchronize cell cycle at the G1/S checkpoint. Scale bar, 100 μm. (B) Phase contrast images of MRC5 cells under conversion at the indicated time points. Scale bar, 100 μm. Insets, super-resolution images of DAPI-stained nuclei. Scale bar, 10 μm. (C) Nuclear volume quantification for MRC5 cells throughout reprogramming. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2. ∗ p < 0.01. (D) Quantification of nuclear area for MRC5 cells throughout reprogramming. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2, ∗ p < 0.01. (E) Quantification of nuclear area at the indicated time points as MRC5, AG22056 newborn foreskin fibroblasts, or GM09918 (78 years) skin fibroblasts were being converted to iNs. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2, ∗ p < 0.01. (F) The average area of MRC5, AG22056, or GM09918 cells as fibroblasts at day −2 (Fib) or TUJ1 + or MAP2 + iNs. ns, no significance. n = 50 frames from three independent experiments. (G) iPSC-derived cortical neurons were co-stained for MAP2 and DAPI at days 30, 40, and 80 of differentiation. Scale bar, 50 μm. Inset, super-resolution images of neuronal nuclei; scale bar, 10 μm. (H) Quantification of nuclear area of the indicated samples. ∗ p < 0.01, vs. the preceding bar (or D30 for iPSC-derived neurons), n = 50 frames from 3 independent experiments.
    Addgene Plko 1 P53 Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+puro+shrna/shp53+pLKO%2E1+puro+(Plasmid+%2319119)/pmc12985393-186-6-6
    Average 93 stars, based on 1 article reviews
    addgene plko 1 p53 shrna - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    Addgene inc plko 1 puro shrna plasmids
    Reduction of nuclear size during the direct conversion of human fibroblasts to neurons (A) Schematic for the transdifferentiation of human fibroblasts to iNs by lentiviruses expressing ASCL1, miR124-9-9 ∗ -BclxL, and <t>p53</t> shRNA (AMp, uppercase for overexpression and lowercase for knockdown). –FBS, serum withdrawal to synchronize cell cycle at the G1/S checkpoint. Scale bar, 100 μm. (B) Phase contrast images of MRC5 cells under conversion at the indicated time points. Scale bar, 100 μm. Insets, super-resolution images of DAPI-stained nuclei. Scale bar, 10 μm. (C) Nuclear volume quantification for MRC5 cells throughout reprogramming. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2. ∗ p < 0.01. (D) Quantification of nuclear area for MRC5 cells throughout reprogramming. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2, ∗ p < 0.01. (E) Quantification of nuclear area at the indicated time points as MRC5, AG22056 newborn foreskin fibroblasts, or GM09918 (78 years) skin fibroblasts were being converted to iNs. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2, ∗ p < 0.01. (F) The average area of MRC5, AG22056, or GM09918 cells as fibroblasts at day −2 (Fib) or TUJ1 + or MAP2 + iNs. ns, no significance. n = 50 frames from three independent experiments. (G) iPSC-derived cortical neurons were co-stained for MAP2 and DAPI at days 30, 40, and 80 of differentiation. Scale bar, 50 μm. Inset, super-resolution images of neuronal nuclei; scale bar, 10 μm. (H) Quantification of nuclear area of the indicated samples. ∗ p < 0.01, vs. the preceding bar (or D30 for iPSC-derived neurons), n = 50 frames from 3 independent experiments.
    Plko 1 Puro Shrna Plasmids, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+puro+shrna/pLKO%2E1+puro+(Plasmid+%238453)/pm41795092-474-12-16
    Average 96 stars, based on 1 article reviews
    plko 1 puro shrna plasmids - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    TaKaRa plko 1 shrna puro
    Reduction of nuclear size during the direct conversion of human fibroblasts to neurons (A) Schematic for the transdifferentiation of human fibroblasts to iNs by lentiviruses expressing ASCL1, miR124-9-9 ∗ -BclxL, and <t>p53</t> shRNA (AMp, uppercase for overexpression and lowercase for knockdown). –FBS, serum withdrawal to synchronize cell cycle at the G1/S checkpoint. Scale bar, 100 μm. (B) Phase contrast images of MRC5 cells under conversion at the indicated time points. Scale bar, 100 μm. Insets, super-resolution images of DAPI-stained nuclei. Scale bar, 10 μm. (C) Nuclear volume quantification for MRC5 cells throughout reprogramming. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2. ∗ p < 0.01. (D) Quantification of nuclear area for MRC5 cells throughout reprogramming. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2, ∗ p < 0.01. (E) Quantification of nuclear area at the indicated time points as MRC5, AG22056 newborn foreskin fibroblasts, or GM09918 (78 years) skin fibroblasts were being converted to iNs. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2, ∗ p < 0.01. (F) The average area of MRC5, AG22056, or GM09918 cells as fibroblasts at day −2 (Fib) or TUJ1 + or MAP2 + iNs. ns, no significance. n = 50 frames from three independent experiments. (G) iPSC-derived cortical neurons were co-stained for MAP2 and DAPI at days 30, 40, and 80 of differentiation. Scale bar, 50 μm. Inset, super-resolution images of neuronal nuclei; scale bar, 10 μm. (H) Quantification of nuclear area of the indicated samples. ∗ p < 0.01, vs. the preceding bar (or D30 for iPSC-derived neurons), n = 50 frames from 3 independent experiments.
    Plko 1 Shrna Puro, supplied by TaKaRa, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+puro+shrna/Puromycin/pm41668200-95-10-11
    Average 96 stars, based on 1 article reviews
    plko 1 shrna puro - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    96
    Addgene inc ccdc6 shrna
    <t>CCDC6-mutated</t> isoforms form heterodimers with the CCDC6 WT protein and affect its intracellular distribution. A, List of myc-tagged CCDC6 mutants identified to date in HGSOC; schematic representation of the GFP-S-tag-CCDC6 WT construct and the S-protein agarose resin. B, S-tag pull-down of HeLa-Kyoto GFP-S-tag-CCDC6 and HeLa-Kyoto control cells, transfected with the myc-tagged CCDC6 mutants A226S, L217P, and P442S expression vectors or with the EV. Isolated proteins were immunoblotted with anti-myc and anti-GFP antibodies. The immunoblots of the whole cell lysates (WCL) with anti-myc, for transfection control, and anti-tubulin, as loading control, are shown at the bottom of the panel. C, Immunofluorescence images of HeLa-Kyoto GFP-S-tag-CCDC6 transfected with the myc-CCDC6 WT (e–h); the mutated isoforms A226S, L217P, and P442S expression vectors (i–t); or the EV as control (a–d). Nuclei are stained with Hoechst (blue channel). CCDC6 WT is shown as the endogenous GFP-S-tag-CCDC6 (green channel). The mutated isoforms were visualized by the anti-myc antibody (red channel). Quantification of the cytoplasmic-to-nuclear (Cyto/Nuclear) ratio of GFP-CCDC6 WT is shown on the right. Statistical significance was determined using one-way ANOVA (ns, not significant; ***, P < 0.001; ****, P < 0.0001). Colocalization metrics were computed using Pearson’s correlation coefficient (R) (values are reported in the table). D, The expression levels of CCDC6 (endogenous, GFP-tagged, and Myc-tagged forms) were assessed by Western blot using the anti-CCDC6 antibody. Tubulin is shown as a loading control.
    Ccdc6 Shrna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+puro+shrna/pLKO%2E1+puro+(Plasmid+%238453)/pmc12833555-42-0-5
    Average 96 stars, based on 1 article reviews
    ccdc6 shrna - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc non targeting control plko 1 puro plasmid dna ntc
    <t>CCDC6-mutated</t> isoforms form heterodimers with the CCDC6 WT protein and affect its intracellular distribution. A, List of myc-tagged CCDC6 mutants identified to date in HGSOC; schematic representation of the GFP-S-tag-CCDC6 WT construct and the S-protein agarose resin. B, S-tag pull-down of HeLa-Kyoto GFP-S-tag-CCDC6 and HeLa-Kyoto control cells, transfected with the myc-tagged CCDC6 mutants A226S, L217P, and P442S expression vectors or with the EV. Isolated proteins were immunoblotted with anti-myc and anti-GFP antibodies. The immunoblots of the whole cell lysates (WCL) with anti-myc, for transfection control, and anti-tubulin, as loading control, are shown at the bottom of the panel. C, Immunofluorescence images of HeLa-Kyoto GFP-S-tag-CCDC6 transfected with the myc-CCDC6 WT (e–h); the mutated isoforms A226S, L217P, and P442S expression vectors (i–t); or the EV as control (a–d). Nuclei are stained with Hoechst (blue channel). CCDC6 WT is shown as the endogenous GFP-S-tag-CCDC6 (green channel). The mutated isoforms were visualized by the anti-myc antibody (red channel). Quantification of the cytoplasmic-to-nuclear (Cyto/Nuclear) ratio of GFP-CCDC6 WT is shown on the right. Statistical significance was determined using one-way ANOVA (ns, not significant; ***, P < 0.001; ****, P < 0.0001). Colocalization metrics were computed using Pearson’s correlation coefficient (R) (values are reported in the table). D, The expression levels of CCDC6 (endogenous, GFP-tagged, and Myc-tagged forms) were assessed by Western blot using the anti-CCDC6 antibody. Tubulin is shown as a loading control.
    Non Targeting Control Plko 1 Puro Plasmid Dna Ntc, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+puro+shrna/pLKO%2E1+Puro+NT+shRNA+(Plasmid+%23123302)/pmc12788653-276-28-38
    Average 93 stars, based on 1 article reviews
    non targeting control plko 1 puro plasmid dna ntc - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    96
    Addgene inc plko 1 puro shrna expression vector
    <t>CCDC6-mutated</t> isoforms form heterodimers with the CCDC6 WT protein and affect its intracellular distribution. A, List of myc-tagged CCDC6 mutants identified to date in HGSOC; schematic representation of the GFP-S-tag-CCDC6 WT construct and the S-protein agarose resin. B, S-tag pull-down of HeLa-Kyoto GFP-S-tag-CCDC6 and HeLa-Kyoto control cells, transfected with the myc-tagged CCDC6 mutants A226S, L217P, and P442S expression vectors or with the EV. Isolated proteins were immunoblotted with anti-myc and anti-GFP antibodies. The immunoblots of the whole cell lysates (WCL) with anti-myc, for transfection control, and anti-tubulin, as loading control, are shown at the bottom of the panel. C, Immunofluorescence images of HeLa-Kyoto GFP-S-tag-CCDC6 transfected with the myc-CCDC6 WT (e–h); the mutated isoforms A226S, L217P, and P442S expression vectors (i–t); or the EV as control (a–d). Nuclei are stained with Hoechst (blue channel). CCDC6 WT is shown as the endogenous GFP-S-tag-CCDC6 (green channel). The mutated isoforms were visualized by the anti-myc antibody (red channel). Quantification of the cytoplasmic-to-nuclear (Cyto/Nuclear) ratio of GFP-CCDC6 WT is shown on the right. Statistical significance was determined using one-way ANOVA (ns, not significant; ***, P < 0.001; ****, P < 0.0001). Colocalization metrics were computed using Pearson’s correlation coefficient (R) (values are reported in the table). D, The expression levels of CCDC6 (endogenous, GFP-tagged, and Myc-tagged forms) were assessed by Western blot using the anti-CCDC6 antibody. Tubulin is shown as a loading control.
    Plko 1 Puro Shrna Expression Vector, supplied by Addgene inc, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+puro+shrna/pLKO%2E1+puro+(Plasmid+%238453)/pm41268701-456-15-19
    Average 96 stars, based on 1 article reviews
    plko 1 puro shrna expression vector - by Bioz Stars, 2026-09
    96/100 stars
      Buy from Supplier

    93
    Addgene inc gacccugaugagaagauaatt plko 1 puro shrna smarca5 cgtcgaattaaggctgatgtt plko 1 puro shrna β catenin 1248
    sPOM121 localizes at gene promoters through <t>SMARCA5</t> interaction. A, Experimental design to determine sPOM121 chromatin interactome using RIME (left). Venn diagram of commonly identified sPOM121-interacting proteins in three prostate cancer cell lines (right). B, Gene Ontology (GO) molecular functions enriched in sPOM121 protein interactome (g:Profiler). P value computed by a Fisher test corrected with Benjamini–Hochberg FDR. C, Table describing top sPOM121-interacting proteins and their overlap with RNA Pol–interacting proteins from a publicly available proteomic dataset. D, POM121, SMARCA5, DDX54, RBM25, and histone H3 immunoblots after POM121 IP using nuclear (N) and chromatin (Ch) subcellular fraction protein extracts from 22Rv1, DU145, and VCaP cells. Arrows point to both POM121 isoforms. E, Representative images and quantification of POM121–SMARCA5 PLA in control or sPOM121 knockdown (KD) cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. F, Representative images and quantification of POM121–SMARCA5 PLA in a cohort of primary/localized ( n = 14) and metastatic ( n = 14) prostate cancer tissue samples. Black lined circles = matched samples. *, P ≤ 0.05 as determined by a Student t test. G, Venn diagram of sPOM121 and SMARCA5 ChIP-seq peaks at promoter sites in 22Rv1 and DU145 prostate cancer cells. H, Genome browser tracks of SMARCA5 peak enrichment at promoters of sPOM121-specific genes. ChIP-seq and corresponding input DNA of the same gene are plotted. I, ChIP-qPCR analysis of sPOM121 enrichment at gene promoters comparing control and SMARCA5 KD in 22Rv1 and DU145 cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test.
    Gacccugaugagaagauaatt Plko 1 Puro Shrna Smarca5 Cgtcgaattaaggctgatgtt Plko 1 Puro Shrna β Catenin 1248, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/plko+1+puro+shrna/pLKO%2E1%2Esh%2Ebeta-catenin%2E1248+(Plasmid+%2319761)/pmc12580793-267-43-54
    Average 93 stars, based on 1 article reviews
    gacccugaugagaagauaatt plko 1 puro shrna smarca5 cgtcgaattaaggctgatgtt plko 1 puro shrna β catenin 1248 - by Bioz Stars, 2026-09
    93/100 stars
      Buy from Supplier

    Image Search Results


    Pathological TDP-43 elicits glycolytic impairment in cells. a , b Agilent seahorse glycolytic stress test was performed on n = 3 independent biological repeats. Glycolysis and Glycolytic Capacity were measured according to manufacturer’s protocol. ECAR values were normalized to total protein then plotted against time. Individual glycolysis and glycolytic capacity values were normalized to total protein level then to individual control from each biological repeat. a Stable HEK293 cells were overexpressed with either YFP (control), TDP-43 WT or TDP-43 ΔNLS . Data were analyzed by one-way ANOVA followed by post hoc Tukey’s test. b TDP-43 G298S patient iPSC and control iPSC were differentiated into motor neurons with our established protocol. On day 26 following differentiation, cells were treated with MG-132 (1 μM) for 24 h. Data were analyzed by Student’s t-test. c YFP (control), TDP-43 WT or TDP-43 ΔNLS stable cells were transiently transfected with various glycolysis shRNAs. Cell viability was measured via MTT assay. Decreased cell viability in all TDP-43 WT and TDP-43 ΔNLS with various glycolysis shRNA (n = 3). Data were analyzed by one-way ANOVA followed by post hoc Tukey’s test. All data are mean ± SE

    Journal: Acta Neuropathologica

    Article Title: TDP-43 impairs glycolysis by sequestering hexokinase 1 in amyotrophic lateral sclerosis

    doi: 10.1007/s00401-026-02996-6

    Figure Lengend Snippet: Pathological TDP-43 elicits glycolytic impairment in cells. a , b Agilent seahorse glycolytic stress test was performed on n = 3 independent biological repeats. Glycolysis and Glycolytic Capacity were measured according to manufacturer’s protocol. ECAR values were normalized to total protein then plotted against time. Individual glycolysis and glycolytic capacity values were normalized to total protein level then to individual control from each biological repeat. a Stable HEK293 cells were overexpressed with either YFP (control), TDP-43 WT or TDP-43 ΔNLS . Data were analyzed by one-way ANOVA followed by post hoc Tukey’s test. b TDP-43 G298S patient iPSC and control iPSC were differentiated into motor neurons with our established protocol. On day 26 following differentiation, cells were treated with MG-132 (1 μM) for 24 h. Data were analyzed by Student’s t-test. c YFP (control), TDP-43 WT or TDP-43 ΔNLS stable cells were transiently transfected with various glycolysis shRNAs. Cell viability was measured via MTT assay. Decreased cell viability in all TDP-43 WT and TDP-43 ΔNLS with various glycolysis shRNA (n = 3). Data were analyzed by one-way ANOVA followed by post hoc Tukey’s test. All data are mean ± SE

    Article Snippet: The following constructs pcDNA3.2-YFP (addgene #84910), pcDNA3.2-TDP-43 WT -YFP (human) (addgene #84911), pcDNA3.2-TDP-43 ΔNLS -YFP (human) (addgene #84912), pLD-puro-Cc-TARDBP-A315T_VA Plasmid (human TDP-43 A315T) (addgene #141329), pLD-puro-Cc-TARDBP-WT_VA Plasmid (human TDP-43 WT) (addgene #141327), and shRNA control (addgene: #8453) were purchased from addgene.

    Techniques: Control, Transfection, MTT Assay, shRNA

    Reduction of nuclear size during the direct conversion of human fibroblasts to neurons (A) Schematic for the transdifferentiation of human fibroblasts to iNs by lentiviruses expressing ASCL1, miR124-9-9 ∗ -BclxL, and p53 shRNA (AMp, uppercase for overexpression and lowercase for knockdown). –FBS, serum withdrawal to synchronize cell cycle at the G1/S checkpoint. Scale bar, 100 μm. (B) Phase contrast images of MRC5 cells under conversion at the indicated time points. Scale bar, 100 μm. Insets, super-resolution images of DAPI-stained nuclei. Scale bar, 10 μm. (C) Nuclear volume quantification for MRC5 cells throughout reprogramming. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2. ∗ p < 0.01. (D) Quantification of nuclear area for MRC5 cells throughout reprogramming. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2, ∗ p < 0.01. (E) Quantification of nuclear area at the indicated time points as MRC5, AG22056 newborn foreskin fibroblasts, or GM09918 (78 years) skin fibroblasts were being converted to iNs. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2, ∗ p < 0.01. (F) The average area of MRC5, AG22056, or GM09918 cells as fibroblasts at day −2 (Fib) or TUJ1 + or MAP2 + iNs. ns, no significance. n = 50 frames from three independent experiments. (G) iPSC-derived cortical neurons were co-stained for MAP2 and DAPI at days 30, 40, and 80 of differentiation. Scale bar, 50 μm. Inset, super-resolution images of neuronal nuclei; scale bar, 10 μm. (H) Quantification of nuclear area of the indicated samples. ∗ p < 0.01, vs. the preceding bar (or D30 for iPSC-derived neurons), n = 50 frames from 3 independent experiments.

    Journal: Stem Cell Reports

    Article Title: ASCL1 promotes nuclear shrinkage in transdifferentiation by suppressing NUP37

    doi: 10.1016/j.stemcr.2026.102823

    Figure Lengend Snippet: Reduction of nuclear size during the direct conversion of human fibroblasts to neurons (A) Schematic for the transdifferentiation of human fibroblasts to iNs by lentiviruses expressing ASCL1, miR124-9-9 ∗ -BclxL, and p53 shRNA (AMp, uppercase for overexpression and lowercase for knockdown). –FBS, serum withdrawal to synchronize cell cycle at the G1/S checkpoint. Scale bar, 100 μm. (B) Phase contrast images of MRC5 cells under conversion at the indicated time points. Scale bar, 100 μm. Insets, super-resolution images of DAPI-stained nuclei. Scale bar, 10 μm. (C) Nuclear volume quantification for MRC5 cells throughout reprogramming. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2. ∗ p < 0.01. (D) Quantification of nuclear area for MRC5 cells throughout reprogramming. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2, ∗ p < 0.01. (E) Quantification of nuclear area at the indicated time points as MRC5, AG22056 newborn foreskin fibroblasts, or GM09918 (78 years) skin fibroblasts were being converted to iNs. n = 50 frames from 3 independent experiments for each time point, unpaired t test vs. day −2, ∗ p < 0.01. (F) The average area of MRC5, AG22056, or GM09918 cells as fibroblasts at day −2 (Fib) or TUJ1 + or MAP2 + iNs. ns, no significance. n = 50 frames from three independent experiments. (G) iPSC-derived cortical neurons were co-stained for MAP2 and DAPI at days 30, 40, and 80 of differentiation. Scale bar, 50 μm. Inset, super-resolution images of neuronal nuclei; scale bar, 10 μm. (H) Quantification of nuclear area of the indicated samples. ∗ p < 0.01, vs. the preceding bar (or D30 for iPSC-derived neurons), n = 50 frames from 3 independent experiments.

    Article Snippet: We purchased the following plasmids from Addgene: pLKO.1/ p53 shRNA (#19119), pLKO.1/scrambled shRNA (#1864), pMD2.G (#12259), psPAX2 (#12260), pTight-9-124-Bclx (miR9/9 ∗ -124, #60857), pRL-SV40P (#27163), and pGL3 enhancer vector (#212938).

    Techniques: Expressing, shRNA, Over Expression, Knockdown, Staining, Derivative Assay

    NUP37 knockdown significantly enhanced AMp-mediated transdifferentiation and nuclear shrinkage (A) Western blot of NUP37 in MRC5 cells transduced without (−) or with the indicated reprogramming factors. (B–D) MRC5 human fibroblasts reprogrammed with ASCL1, MIR124-9-9 ∗ -BclxL, and p53 shRNA (AMp) (B), AMp and NUP37 shRNA (AMpu) (C), or AMp and NUP37 overexpression (AMpU) (D) were co-stained as indicated on day 14. Scale bar, 100 μm. (E–G) Reprogramming efficiency (E) as measured by the percentages of TUJ1 + or MAP2 + cells among all DAPI + cells, reprogramming yield of MAP2 + cells per frame (F), and the number of DAPI + cells per frame (G) at day 14. # and ∗ , p < 0.05, n = 15 (3 experiments, 5 frames each), vs. AMp for the indicated cell type, unpaired t test. (H) Nuclear area of MAP2 + neurons for each condition. ∗ p < 0.001, n = 50 frames from 3 independent experiments, vs. AMp, unpaired t test. (I–P) MRC5 cells reprogrammed with AMp (I–L) or AMpu (M–P) were co-stained as indicated at different time points. Scale bar, 100 μm. (Q‒S) (Q) Reprogramming efficiency of MAP2 + -generated neurons per DAPI + nuclei. (R) Yield of MAP2 + neurons. (S) Number of DAPI + cells per frame. ∗ p < 0.01, n = 15 (3 experiments, 5 frames each), vs. AMp at the same time point, unpaired t test. (T) RT-qPCR measurement of mature neuronal markers in AMp- or AMpu-induced neurons at D14. ∗ p < 0.05, n = 6 (3 experiments, duplicate for each), vs. AMp, unpaired t test.

    Journal: Stem Cell Reports

    Article Title: ASCL1 promotes nuclear shrinkage in transdifferentiation by suppressing NUP37

    doi: 10.1016/j.stemcr.2026.102823

    Figure Lengend Snippet: NUP37 knockdown significantly enhanced AMp-mediated transdifferentiation and nuclear shrinkage (A) Western blot of NUP37 in MRC5 cells transduced without (−) or with the indicated reprogramming factors. (B–D) MRC5 human fibroblasts reprogrammed with ASCL1, MIR124-9-9 ∗ -BclxL, and p53 shRNA (AMp) (B), AMp and NUP37 shRNA (AMpu) (C), or AMp and NUP37 overexpression (AMpU) (D) were co-stained as indicated on day 14. Scale bar, 100 μm. (E–G) Reprogramming efficiency (E) as measured by the percentages of TUJ1 + or MAP2 + cells among all DAPI + cells, reprogramming yield of MAP2 + cells per frame (F), and the number of DAPI + cells per frame (G) at day 14. # and ∗ , p < 0.05, n = 15 (3 experiments, 5 frames each), vs. AMp for the indicated cell type, unpaired t test. (H) Nuclear area of MAP2 + neurons for each condition. ∗ p < 0.001, n = 50 frames from 3 independent experiments, vs. AMp, unpaired t test. (I–P) MRC5 cells reprogrammed with AMp (I–L) or AMpu (M–P) were co-stained as indicated at different time points. Scale bar, 100 μm. (Q‒S) (Q) Reprogramming efficiency of MAP2 + -generated neurons per DAPI + nuclei. (R) Yield of MAP2 + neurons. (S) Number of DAPI + cells per frame. ∗ p < 0.01, n = 15 (3 experiments, 5 frames each), vs. AMp at the same time point, unpaired t test. (T) RT-qPCR measurement of mature neuronal markers in AMp- or AMpu-induced neurons at D14. ∗ p < 0.05, n = 6 (3 experiments, duplicate for each), vs. AMp, unpaired t test.

    Article Snippet: We purchased the following plasmids from Addgene: pLKO.1/ p53 shRNA (#19119), pLKO.1/scrambled shRNA (#1864), pMD2.G (#12259), psPAX2 (#12260), pTight-9-124-Bclx (miR9/9 ∗ -124, #60857), pRL-SV40P (#27163), and pGL3 enhancer vector (#212938).

    Techniques: Knockdown, Western Blot, shRNA, Over Expression, Staining, Generated, Quantitative RT-PCR

    Cooperation of ASCL1 and NUP37 shRNA in reprogramming and nuclear shrinkage (A–P) MRC5 human fibroblasts were reprogrammed without or with the indicated combinations of ASCL1 (A), miR124-9-9 ∗ -BclxL (M), p53 shRNA (p) and NUP37 shRNA (u), and co-stained as indicated at day 14. Bar, 100 μm. (Q–S) Reprogramming efficiency (Q) as measured by the percentages of TUJ1 + or MAP2 + cells among all DAPI + cells, reprogramming yield of MAP2 + cells per frame (R), and the number of DAPI + cells per frame (S) at day 14. # and ∗ , p < 0.001, n = 15 (3 experiments, 5 frames each), vs. the corresponding condition without u for the indicated cell type, unpaired t test. $ p < 0.001, n = 15 (3 experiments, 5 frames each), vs. no virus (−V), unpaired t test. (T) Nuclear area for each condition. ∗ p < 0.05, n = 50 frames from 3 independent experiments, vs. the corresponding condition without u; unpaired t test. $ p < 0.005, n = 50 frames from 3 independent experiments, vs. no virus (−V), unpaired t test.

    Journal: Stem Cell Reports

    Article Title: ASCL1 promotes nuclear shrinkage in transdifferentiation by suppressing NUP37

    doi: 10.1016/j.stemcr.2026.102823

    Figure Lengend Snippet: Cooperation of ASCL1 and NUP37 shRNA in reprogramming and nuclear shrinkage (A–P) MRC5 human fibroblasts were reprogrammed without or with the indicated combinations of ASCL1 (A), miR124-9-9 ∗ -BclxL (M), p53 shRNA (p) and NUP37 shRNA (u), and co-stained as indicated at day 14. Bar, 100 μm. (Q–S) Reprogramming efficiency (Q) as measured by the percentages of TUJ1 + or MAP2 + cells among all DAPI + cells, reprogramming yield of MAP2 + cells per frame (R), and the number of DAPI + cells per frame (S) at day 14. # and ∗ , p < 0.001, n = 15 (3 experiments, 5 frames each), vs. the corresponding condition without u for the indicated cell type, unpaired t test. $ p < 0.001, n = 15 (3 experiments, 5 frames each), vs. no virus (−V), unpaired t test. (T) Nuclear area for each condition. ∗ p < 0.05, n = 50 frames from 3 independent experiments, vs. the corresponding condition without u; unpaired t test. $ p < 0.005, n = 50 frames from 3 independent experiments, vs. no virus (−V), unpaired t test.

    Article Snippet: We purchased the following plasmids from Addgene: pLKO.1/ p53 shRNA (#19119), pLKO.1/scrambled shRNA (#1864), pMD2.G (#12259), psPAX2 (#12260), pTight-9-124-Bclx (miR9/9 ∗ -124, #60857), pRL-SV40P (#27163), and pGL3 enhancer vector (#212938).

    Techniques: shRNA, Staining, Virus

    CCDC6-mutated isoforms form heterodimers with the CCDC6 WT protein and affect its intracellular distribution. A, List of myc-tagged CCDC6 mutants identified to date in HGSOC; schematic representation of the GFP-S-tag-CCDC6 WT construct and the S-protein agarose resin. B, S-tag pull-down of HeLa-Kyoto GFP-S-tag-CCDC6 and HeLa-Kyoto control cells, transfected with the myc-tagged CCDC6 mutants A226S, L217P, and P442S expression vectors or with the EV. Isolated proteins were immunoblotted with anti-myc and anti-GFP antibodies. The immunoblots of the whole cell lysates (WCL) with anti-myc, for transfection control, and anti-tubulin, as loading control, are shown at the bottom of the panel. C, Immunofluorescence images of HeLa-Kyoto GFP-S-tag-CCDC6 transfected with the myc-CCDC6 WT (e–h); the mutated isoforms A226S, L217P, and P442S expression vectors (i–t); or the EV as control (a–d). Nuclei are stained with Hoechst (blue channel). CCDC6 WT is shown as the endogenous GFP-S-tag-CCDC6 (green channel). The mutated isoforms were visualized by the anti-myc antibody (red channel). Quantification of the cytoplasmic-to-nuclear (Cyto/Nuclear) ratio of GFP-CCDC6 WT is shown on the right. Statistical significance was determined using one-way ANOVA (ns, not significant; ***, P < 0.001; ****, P < 0.0001). Colocalization metrics were computed using Pearson’s correlation coefficient (R) (values are reported in the table). D, The expression levels of CCDC6 (endogenous, GFP-tagged, and Myc-tagged forms) were assessed by Western blot using the anti-CCDC6 antibody. Tubulin is shown as a loading control.

    Journal: Cancer Research Communications

    Article Title: CCDC6 Immunostaining in Conjunction with the Rad51 HRD Assay May Expand PARPi Treatment Eligibility in Patients with HGSOC

    doi: 10.1158/2767-9764.CRC-25-0455

    Figure Lengend Snippet: CCDC6-mutated isoforms form heterodimers with the CCDC6 WT protein and affect its intracellular distribution. A, List of myc-tagged CCDC6 mutants identified to date in HGSOC; schematic representation of the GFP-S-tag-CCDC6 WT construct and the S-protein agarose resin. B, S-tag pull-down of HeLa-Kyoto GFP-S-tag-CCDC6 and HeLa-Kyoto control cells, transfected with the myc-tagged CCDC6 mutants A226S, L217P, and P442S expression vectors or with the EV. Isolated proteins were immunoblotted with anti-myc and anti-GFP antibodies. The immunoblots of the whole cell lysates (WCL) with anti-myc, for transfection control, and anti-tubulin, as loading control, are shown at the bottom of the panel. C, Immunofluorescence images of HeLa-Kyoto GFP-S-tag-CCDC6 transfected with the myc-CCDC6 WT (e–h); the mutated isoforms A226S, L217P, and P442S expression vectors (i–t); or the EV as control (a–d). Nuclei are stained with Hoechst (blue channel). CCDC6 WT is shown as the endogenous GFP-S-tag-CCDC6 (green channel). The mutated isoforms were visualized by the anti-myc antibody (red channel). Quantification of the cytoplasmic-to-nuclear (Cyto/Nuclear) ratio of GFP-CCDC6 WT is shown on the right. Statistical significance was determined using one-way ANOVA (ns, not significant; ***, P < 0.001; ****, P < 0.0001). Colocalization metrics were computed using Pearson’s correlation coefficient (R) (values are reported in the table). D, The expression levels of CCDC6 (endogenous, GFP-tagged, and Myc-tagged forms) were assessed by Western blot using the anti-CCDC6 antibody. Tubulin is shown as a loading control.

    Article Snippet: CCDC6 shRNA (pLKO.1 puro, RRID: Addgene_8453) was purchased from Sigma-Aldrich.

    Techniques: Construct, Control, Transfection, Expressing, Isolation, Western Blot, Immunofluorescence, Staining

    CCDC6 inactivation reduces RAD51 foci formation in HGSOC cells. A and B, Representative immunofluorescence images and quantitative analysis of RAD51 foci formation in OVCAR3 ( A ) and OV90 ( B ) cells transfected with the myc-tagged CCDC6 WT; the mutated isoforms A226S, L217P, and P442S expression vectors; or the EV as a control, following treatment with etoposide (10 μmol/L) for 8 hours. Graphs represent the percentage of cells with more than five foci. Error bars indicate the SEM derived from three independent experiments. Statistical significance was verified by one-way ANOVA (****, P < 0.0001). C and D, Representative immunofluorescence images and quantitative analysis of RAD51 foci formation in OVCAR3 ( C ) and OV90 ( D ) cells stably silenced for CCDC6 (shCCDC6) and transfected with the myc-tagged CCDC6 WT; the mutated isoforms A226S, L217P, and P442S expression vectors; or the EV and control cells (shCTRL), following treatment with etoposide (10 μmol/L) for 8 hours. Graphs represent the percentage of cells with more than five foci. Error bars indicate the SEM derived from three independent experiments. Statistical significance was verified by one-way ANOVA (****, P < 0.0001).

    Journal: Cancer Research Communications

    Article Title: CCDC6 Immunostaining in Conjunction with the Rad51 HRD Assay May Expand PARPi Treatment Eligibility in Patients with HGSOC

    doi: 10.1158/2767-9764.CRC-25-0455

    Figure Lengend Snippet: CCDC6 inactivation reduces RAD51 foci formation in HGSOC cells. A and B, Representative immunofluorescence images and quantitative analysis of RAD51 foci formation in OVCAR3 ( A ) and OV90 ( B ) cells transfected with the myc-tagged CCDC6 WT; the mutated isoforms A226S, L217P, and P442S expression vectors; or the EV as a control, following treatment with etoposide (10 μmol/L) for 8 hours. Graphs represent the percentage of cells with more than five foci. Error bars indicate the SEM derived from three independent experiments. Statistical significance was verified by one-way ANOVA (****, P < 0.0001). C and D, Representative immunofluorescence images and quantitative analysis of RAD51 foci formation in OVCAR3 ( C ) and OV90 ( D ) cells stably silenced for CCDC6 (shCCDC6) and transfected with the myc-tagged CCDC6 WT; the mutated isoforms A226S, L217P, and P442S expression vectors; or the EV and control cells (shCTRL), following treatment with etoposide (10 μmol/L) for 8 hours. Graphs represent the percentage of cells with more than five foci. Error bars indicate the SEM derived from three independent experiments. Statistical significance was verified by one-way ANOVA (****, P < 0.0001).

    Article Snippet: CCDC6 shRNA (pLKO.1 puro, RRID: Addgene_8453) was purchased from Sigma-Aldrich.

    Techniques: Immunofluorescence, Transfection, Expressing, Control, Derivative Assay, Stable Transfection

    Mutated isoforms of CCDC6 sensitize HGSOC cells to the PARPi olaparib alone or in combination with cisplatin. A–D, Drug sensitivity to olaparib or cisplatin has been evaluated by cell viability assay (CellTiter 96 Aqueous One Solution assay, Promega) in OVCAR3 and OV90 cell lines transfected with the myc-CCDC6 mutated isoforms L217P, A226S, and P442S or with the EV and exposed to the drug for 144 hours. The drug sensitivity is expressed as IC 50 values. Statistical significance was verified by two-way ANOVA (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001). E, The CI values according to the 1:2 concentration ratio of cisplatin and olaparib are shown (CI < 1, CI = 1, and CI > 1 indicate synergism, additive effect, and antagonism, respectively).

    Journal: Cancer Research Communications

    Article Title: CCDC6 Immunostaining in Conjunction with the Rad51 HRD Assay May Expand PARPi Treatment Eligibility in Patients with HGSOC

    doi: 10.1158/2767-9764.CRC-25-0455

    Figure Lengend Snippet: Mutated isoforms of CCDC6 sensitize HGSOC cells to the PARPi olaparib alone or in combination with cisplatin. A–D, Drug sensitivity to olaparib or cisplatin has been evaluated by cell viability assay (CellTiter 96 Aqueous One Solution assay, Promega) in OVCAR3 and OV90 cell lines transfected with the myc-CCDC6 mutated isoforms L217P, A226S, and P442S or with the EV and exposed to the drug for 144 hours. The drug sensitivity is expressed as IC 50 values. Statistical significance was verified by two-way ANOVA (*, P < 0.05; **, P < 0.01; ***, P < 0.001; ****, P < 0.0001). E, The CI values according to the 1:2 concentration ratio of cisplatin and olaparib are shown (CI < 1, CI = 1, and CI > 1 indicate synergism, additive effect, and antagonism, respectively).

    Article Snippet: CCDC6 shRNA (pLKO.1 puro, RRID: Addgene_8453) was purchased from Sigma-Aldrich.

    Techniques: Viability Assay, Transfection, Concentration Assay

    CCDC6 inactivation correlates with an HRD phenotype in patients with HGSOC. A, Representative images of IHC analysis of CCDC6 expression (a–c) and localization (d–f) in FFPE MITO16A patient samples (magnification 40×). The H-score values are listed as follows: a, (9); b, (50.68); c, (138.86); d, (149.61); e, (194.51); and f, (262.82). B, Summary of the MITO16A cases with CCDC6 inactivation, assessed for HRD test and/or RAD51 test and/or BRCA1/2 status. C, Causes of failure for the RAD51 assay in CCDC6 inactive samples. D, Percentages of Homologous Recombination Proficiency (HRP) and HRD tumors assessed by functional HRD testing among CCDC6 inactive MITO16A samples. E, Percentages of non-HRD and HRD tumors assessed by genomic HRD testing among CCDC6 inactive MITO16A samples. F, Percentage of BRCA1 and BRCA2 WT or mutated tumors among CCDC6-inactive MITO16A samples.

    Journal: Cancer Research Communications

    Article Title: CCDC6 Immunostaining in Conjunction with the Rad51 HRD Assay May Expand PARPi Treatment Eligibility in Patients with HGSOC

    doi: 10.1158/2767-9764.CRC-25-0455

    Figure Lengend Snippet: CCDC6 inactivation correlates with an HRD phenotype in patients with HGSOC. A, Representative images of IHC analysis of CCDC6 expression (a–c) and localization (d–f) in FFPE MITO16A patient samples (magnification 40×). The H-score values are listed as follows: a, (9); b, (50.68); c, (138.86); d, (149.61); e, (194.51); and f, (262.82). B, Summary of the MITO16A cases with CCDC6 inactivation, assessed for HRD test and/or RAD51 test and/or BRCA1/2 status. C, Causes of failure for the RAD51 assay in CCDC6 inactive samples. D, Percentages of Homologous Recombination Proficiency (HRP) and HRD tumors assessed by functional HRD testing among CCDC6 inactive MITO16A samples. E, Percentages of non-HRD and HRD tumors assessed by genomic HRD testing among CCDC6 inactive MITO16A samples. F, Percentage of BRCA1 and BRCA2 WT or mutated tumors among CCDC6-inactive MITO16A samples.

    Article Snippet: CCDC6 shRNA (pLKO.1 puro, RRID: Addgene_8453) was purchased from Sigma-Aldrich.

    Techniques: Expressing, Homologous Recombination, Functional Assay

    sPOM121 localizes at gene promoters through SMARCA5 interaction. A, Experimental design to determine sPOM121 chromatin interactome using RIME (left). Venn diagram of commonly identified sPOM121-interacting proteins in three prostate cancer cell lines (right). B, Gene Ontology (GO) molecular functions enriched in sPOM121 protein interactome (g:Profiler). P value computed by a Fisher test corrected with Benjamini–Hochberg FDR. C, Table describing top sPOM121-interacting proteins and their overlap with RNA Pol–interacting proteins from a publicly available proteomic dataset. D, POM121, SMARCA5, DDX54, RBM25, and histone H3 immunoblots after POM121 IP using nuclear (N) and chromatin (Ch) subcellular fraction protein extracts from 22Rv1, DU145, and VCaP cells. Arrows point to both POM121 isoforms. E, Representative images and quantification of POM121–SMARCA5 PLA in control or sPOM121 knockdown (KD) cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. F, Representative images and quantification of POM121–SMARCA5 PLA in a cohort of primary/localized ( n = 14) and metastatic ( n = 14) prostate cancer tissue samples. Black lined circles = matched samples. *, P ≤ 0.05 as determined by a Student t test. G, Venn diagram of sPOM121 and SMARCA5 ChIP-seq peaks at promoter sites in 22Rv1 and DU145 prostate cancer cells. H, Genome browser tracks of SMARCA5 peak enrichment at promoters of sPOM121-specific genes. ChIP-seq and corresponding input DNA of the same gene are plotted. I, ChIP-qPCR analysis of sPOM121 enrichment at gene promoters comparing control and SMARCA5 KD in 22Rv1 and DU145 cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test.

    Journal: Cancer Discovery

    Article Title: Off-pore Nucleoporin sPOM121 Transcriptionally Propels β-Catenin–driven Tumor Progression and Immune Escape in Prostate Cancer

    doi: 10.1158/2159-8290.CD-25-0629

    Figure Lengend Snippet: sPOM121 localizes at gene promoters through SMARCA5 interaction. A, Experimental design to determine sPOM121 chromatin interactome using RIME (left). Venn diagram of commonly identified sPOM121-interacting proteins in three prostate cancer cell lines (right). B, Gene Ontology (GO) molecular functions enriched in sPOM121 protein interactome (g:Profiler). P value computed by a Fisher test corrected with Benjamini–Hochberg FDR. C, Table describing top sPOM121-interacting proteins and their overlap with RNA Pol–interacting proteins from a publicly available proteomic dataset. D, POM121, SMARCA5, DDX54, RBM25, and histone H3 immunoblots after POM121 IP using nuclear (N) and chromatin (Ch) subcellular fraction protein extracts from 22Rv1, DU145, and VCaP cells. Arrows point to both POM121 isoforms. E, Representative images and quantification of POM121–SMARCA5 PLA in control or sPOM121 knockdown (KD) cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. F, Representative images and quantification of POM121–SMARCA5 PLA in a cohort of primary/localized ( n = 14) and metastatic ( n = 14) prostate cancer tissue samples. Black lined circles = matched samples. *, P ≤ 0.05 as determined by a Student t test. G, Venn diagram of sPOM121 and SMARCA5 ChIP-seq peaks at promoter sites in 22Rv1 and DU145 prostate cancer cells. H, Genome browser tracks of SMARCA5 peak enrichment at promoters of sPOM121-specific genes. ChIP-seq and corresponding input DNA of the same gene are plotted. I, ChIP-qPCR analysis of sPOM121 enrichment at gene promoters comparing control and SMARCA5 KD in 22Rv1 and DU145 cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test.

    Article Snippet: Details of the shRNA and siRNA used in this study are listed below: GL2 siRNA control: CGUACGCGGAAUACUUCGA sPOM121 siRNA#1 (5′UTR): GCAACUUGCCCAAGUCCUU sPOM121 siRNA#2 (5′UTR): GACCCUGAUGAGAAGAUAA pLKO.1 puro non-target shRNA control: SHC016 shRNA MISSION Sigma pLKO.1 puro shRNA sPOM121#1: GCAACUUGCCCAAGUCCUUTT pLKO.1 puro shRNA sPOM121#2: GACCCUGAUGAGAAGAUAATT pLKO.1 puro shRNA SMARCA5: CGTCGAATTAAGGCTGATGTT pLKO.1 puro shRNA β-catenin.1248: (RRID: Addgene_ 19761)

    Techniques: Western Blot, Control, Knockdown, ChIP-sequencing, ChIP-qPCR

    The C-terminus of sPOM121 is essential for SMARCA5 interaction and localization to nucleoplasmic condensates. A, Diagram of GFP-fused sPOM121 deletion mutant proteins. N terminal (NT), middle (M) and C terminal (CT) protein fragments are highlighted in orange, yellow, and purple, respectively. FL, full length. B, GFP and SMARCA5 immunoblots after GFP IP from 22Rv1 cells stably expressing sPOM121 fragments under endogenous sPOM121 knockdown. C, SMARCA5 and GFP immunoblots after SMARCA5 IP from 22Rv1 cells stably expressing sPOM121 fragments under endogenous sPOM121 knockdown. D, ChIP-qPCR enrichment of GFP at gene promoters of indicated genes comparing FL, ΔC, and CT sPOM121-GFP under endogenous sPOM121 knockdown in 22Rv1 cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. E, Representative GFP IF z-projection images and quantification of nucleoplasmic foci in 22Rv1 cells expressing FL, ΔC, and CT sPOM121-GFP under endogenous sPOM121 knockdown. A total of 60 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. F, POM121 and FUS immunoblots from input, supernatant, and pellet of 22Rv1 chromatin fractions treated with 33 or 100 μmol/L b-isox. G, Representative POM121 IF z-projection images and nucleoplasmic foci quantification of endogenous sPOM121 in 22Rv1 cells treated with vehicle or with 5% HD for the indicated times. A total of 36 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05, determined by Student t test. H, Representative images and quantification of fluorescence recovery of sPOM121-GFP nuclear foci after photobleaching (FRAP) in 22Rv1 cells. A total of 30 cells were assessed. I, Diagram of wild type (WT) and FG repeats mutant (FS, phenylalanine to serine substitution) in FL and CT sPOM121 proteins. Representative GFP IF z-projection images and quantification of nucleoplasmic foci in 22Rv1 cells expressing FL and CT sPOM121-GFP, wild-type (WT) or FS, under endogenous sPOM121 knockdown. A total of 60 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. J, GFP and SMARCA5 ChIP-qPCR enrichment at gene promoters of indicated genes comparing 22Rv1 cells expressing either sPOM121-GFP WT or FS mutant under endogenous sPOM121 knockdown. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. K, GFP and SMARCA5 immunoblots after GFP IP from 22Rv1 cells stably expressing WT or FS mutant FL and CT sPOM121, under endogenous sPOM121 knockdown. L, Diagram of sPOM121-FL and FUS-IDR chimera proteins. Representative GFP IF images and quantification of nucleoplasmic foci in 22Rv1 cells expressing sPOM121-FL or the sPOM121 FUS-IDR chimera, under endogenous sPOM121 knockdown. A total of 60 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. n.s., non-significant. M, GFP and SMARCA5 immunoblots after GFP IP from 22Rv1 cells stably expressing sPOM121 WT or the FUS-IDR chimera, under endogenous sPOM121 knockdown. N, Nascent mRNA quantification of indicated genes in 22Rv1 cells expressing sPOM121-FL WT, FS-mutant, or FUS-IDR chimera, under endogenous sPOM121 knockdown. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test.

    Journal: Cancer Discovery

    Article Title: Off-pore Nucleoporin sPOM121 Transcriptionally Propels β-Catenin–driven Tumor Progression and Immune Escape in Prostate Cancer

    doi: 10.1158/2159-8290.CD-25-0629

    Figure Lengend Snippet: The C-terminus of sPOM121 is essential for SMARCA5 interaction and localization to nucleoplasmic condensates. A, Diagram of GFP-fused sPOM121 deletion mutant proteins. N terminal (NT), middle (M) and C terminal (CT) protein fragments are highlighted in orange, yellow, and purple, respectively. FL, full length. B, GFP and SMARCA5 immunoblots after GFP IP from 22Rv1 cells stably expressing sPOM121 fragments under endogenous sPOM121 knockdown. C, SMARCA5 and GFP immunoblots after SMARCA5 IP from 22Rv1 cells stably expressing sPOM121 fragments under endogenous sPOM121 knockdown. D, ChIP-qPCR enrichment of GFP at gene promoters of indicated genes comparing FL, ΔC, and CT sPOM121-GFP under endogenous sPOM121 knockdown in 22Rv1 cells. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. E, Representative GFP IF z-projection images and quantification of nucleoplasmic foci in 22Rv1 cells expressing FL, ΔC, and CT sPOM121-GFP under endogenous sPOM121 knockdown. A total of 60 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. F, POM121 and FUS immunoblots from input, supernatant, and pellet of 22Rv1 chromatin fractions treated with 33 or 100 μmol/L b-isox. G, Representative POM121 IF z-projection images and nucleoplasmic foci quantification of endogenous sPOM121 in 22Rv1 cells treated with vehicle or with 5% HD for the indicated times. A total of 36 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05, determined by Student t test. H, Representative images and quantification of fluorescence recovery of sPOM121-GFP nuclear foci after photobleaching (FRAP) in 22Rv1 cells. A total of 30 cells were assessed. I, Diagram of wild type (WT) and FG repeats mutant (FS, phenylalanine to serine substitution) in FL and CT sPOM121 proteins. Representative GFP IF z-projection images and quantification of nucleoplasmic foci in 22Rv1 cells expressing FL and CT sPOM121-GFP, wild-type (WT) or FS, under endogenous sPOM121 knockdown. A total of 60 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. J, GFP and SMARCA5 ChIP-qPCR enrichment at gene promoters of indicated genes comparing 22Rv1 cells expressing either sPOM121-GFP WT or FS mutant under endogenous sPOM121 knockdown. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test. K, GFP and SMARCA5 immunoblots after GFP IP from 22Rv1 cells stably expressing WT or FS mutant FL and CT sPOM121, under endogenous sPOM121 knockdown. L, Diagram of sPOM121-FL and FUS-IDR chimera proteins. Representative GFP IF images and quantification of nucleoplasmic foci in 22Rv1 cells expressing sPOM121-FL or the sPOM121 FUS-IDR chimera, under endogenous sPOM121 knockdown. A total of 60 nuclei for each condition were quantified. Data represent the mean ± SD of at least three independent experiments. n.s., non-significant. M, GFP and SMARCA5 immunoblots after GFP IP from 22Rv1 cells stably expressing sPOM121 WT or the FUS-IDR chimera, under endogenous sPOM121 knockdown. N, Nascent mRNA quantification of indicated genes in 22Rv1 cells expressing sPOM121-FL WT, FS-mutant, or FUS-IDR chimera, under endogenous sPOM121 knockdown. Data represent the mean ± SD of at least three independent experiments. *, P ≤ 0.05 as determined by a Student t test.

    Article Snippet: Details of the shRNA and siRNA used in this study are listed below: GL2 siRNA control: CGUACGCGGAAUACUUCGA sPOM121 siRNA#1 (5′UTR): GCAACUUGCCCAAGUCCUU sPOM121 siRNA#2 (5′UTR): GACCCUGAUGAGAAGAUAA pLKO.1 puro non-target shRNA control: SHC016 shRNA MISSION Sigma pLKO.1 puro shRNA sPOM121#1: GCAACUUGCCCAAGUCCUUTT pLKO.1 puro shRNA sPOM121#2: GACCCUGAUGAGAAGAUAATT pLKO.1 puro shRNA SMARCA5: CGTCGAATTAAGGCTGATGTT pLKO.1 puro shRNA β-catenin.1248: (RRID: Addgene_ 19761)

    Techniques: Mutagenesis, Western Blot, Stable Transfection, Expressing, Knockdown, ChIP-qPCR, Fluorescence

    sPOM121 reprograms lethal prostate cancer. A, Venn diagram showcases the overlap of genes from RNA-seq of sPOM121 knockdown (KD), ATAC-seq of sPOM121 KD, and ATAC-seq of SMARCA5 KD of 22Rv1 and DU145 cells at promoter sites. B, Heatmap of sPOM121–target gene promoter signature obtained upon sPOM121 KD. Red and blue indicate high and low gene expression, respectively. C, ATAC-seq genome browser tracks of specific gene promoters comparing control vs. sPOM121 KD. D, ATAC-seq genome browser tracks of specific gene promoters comparing control vs. SMARCA5 KD. E, Gene set enrichment analysis of sPOM121–target gene signature in Hallmark, Reactome, and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. F, Left, modulation of the sPOM121–target gene expression signature in a publicly available patient sample dataset containing primary/localized prostate cancer and metastatic warm autopsy samples (Grasso GSE35988 ). Right, gene set enrichment (GSEA) index box plot.

    Journal: Cancer Discovery

    Article Title: Off-pore Nucleoporin sPOM121 Transcriptionally Propels β-Catenin–driven Tumor Progression and Immune Escape in Prostate Cancer

    doi: 10.1158/2159-8290.CD-25-0629

    Figure Lengend Snippet: sPOM121 reprograms lethal prostate cancer. A, Venn diagram showcases the overlap of genes from RNA-seq of sPOM121 knockdown (KD), ATAC-seq of sPOM121 KD, and ATAC-seq of SMARCA5 KD of 22Rv1 and DU145 cells at promoter sites. B, Heatmap of sPOM121–target gene promoter signature obtained upon sPOM121 KD. Red and blue indicate high and low gene expression, respectively. C, ATAC-seq genome browser tracks of specific gene promoters comparing control vs. sPOM121 KD. D, ATAC-seq genome browser tracks of specific gene promoters comparing control vs. SMARCA5 KD. E, Gene set enrichment analysis of sPOM121–target gene signature in Hallmark, Reactome, and Kyoto Encyclopedia of Genes and Genomes (KEGG) databases. F, Left, modulation of the sPOM121–target gene expression signature in a publicly available patient sample dataset containing primary/localized prostate cancer and metastatic warm autopsy samples (Grasso GSE35988 ). Right, gene set enrichment (GSEA) index box plot.

    Article Snippet: Details of the shRNA and siRNA used in this study are listed below: GL2 siRNA control: CGUACGCGGAAUACUUCGA sPOM121 siRNA#1 (5′UTR): GCAACUUGCCCAAGUCCUU sPOM121 siRNA#2 (5′UTR): GACCCUGAUGAGAAGAUAA pLKO.1 puro non-target shRNA control: SHC016 shRNA MISSION Sigma pLKO.1 puro shRNA sPOM121#1: GCAACUUGCCCAAGUCCUUTT pLKO.1 puro shRNA sPOM121#2: GACCCUGAUGAGAAGAUAATT pLKO.1 puro shRNA SMARCA5: CGTCGAATTAAGGCTGATGTT pLKO.1 puro shRNA β-catenin.1248: (RRID: Addgene_ 19761)

    Techniques: RNA Sequencing, Knockdown, Gene Expression, Control, Targeted Gene Expression